View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13705_high_3 (Length: 240)

Name: NF13705_high_3
Description: NF13705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13705_high_3
NF13705_high_3
[»] chr7 (3 HSPs)
chr7 (17-148)||(238682-238813)
chr7 (189-225)||(238909-238945)
chr7 (57-108)||(224766-224817)


Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 17 - 148
Target Start/End: Original strand, 238682 - 238813
Alignment:
17 aatattttgtgtagttgttgttgttgttgctgaagtcaaaaacatggccattagtcacaacactttggcttttacctttggcatgcttggtacgtagaat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
238682 aatattttgtgtagttgttgttgttgttgctgaagtcaaaaacatggccattagtcacaacactttggcttttacctttggcatgcttggtacgtagcat 238781  T
117 aaagttaaacacatgacacataattgtatttt 148  Q
    ||||||||||||||||||||||||||||||||    
238782 aaagttaaacacatgacacataattgtatttt 238813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 225
Target Start/End: Original strand, 238909 - 238945
Alignment:
189 taaaaatcaatgcatataggttaatcccacttcattt 225  Q
    |||| ||||||||||||||||||||||||||||||||    
238909 taaatatcaatgcatataggttaatcccacttcattt 238945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 57 - 108
Target Start/End: Original strand, 224766 - 224817
Alignment:
57 aacatggccattagtcacaacactttggcttttacctttggcatgcttggta 108  Q
    |||||||| || ||||||||||||||||| ||| ||||||||||||| ||||    
224766 aacatggcaatcagtcacaacactttggcatttgcctttggcatgctaggta 224817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University