View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13705_low_3 (Length: 240)
Name: NF13705_low_3
Description: NF13705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13705_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 17 - 148
Target Start/End: Original strand, 238682 - 238813
Alignment:
| Q |
17 |
aatattttgtgtagttgttgttgttgttgctgaagtcaaaaacatggccattagtcacaacactttggcttttacctttggcatgcttggtacgtagaat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
238682 |
aatattttgtgtagttgttgttgttgttgctgaagtcaaaaacatggccattagtcacaacactttggcttttacctttggcatgcttggtacgtagcat |
238781 |
T |
|
| Q |
117 |
aaagttaaacacatgacacataattgtatttt |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
238782 |
aaagttaaacacatgacacataattgtatttt |
238813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 225
Target Start/End: Original strand, 238909 - 238945
Alignment:
| Q |
189 |
taaaaatcaatgcatataggttaatcccacttcattt |
225 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
238909 |
taaatatcaatgcatataggttaatcccacttcattt |
238945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 57 - 108
Target Start/End: Original strand, 224766 - 224817
Alignment:
| Q |
57 |
aacatggccattagtcacaacactttggcttttacctttggcatgcttggta |
108 |
Q |
| |
|
|||||||| || ||||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
224766 |
aacatggcaatcagtcacaacactttggcatttgcctttggcatgctaggta |
224817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University