View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13706_high_18 (Length: 393)
Name: NF13706_high_18
Description: NF13706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13706_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 2e-59; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 160 - 284
Target Start/End: Original strand, 48412525 - 48412649
Alignment:
| Q |
160 |
acttgggacgaatggagagttcggtggctttagtgtgaactttgagagcggccatcatttcattgttgcggcgaatgttttcgagtcgtttgcgttcgta |
259 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48412525 |
acttgggaagaatggagagttcggtggctttagtgtgaactttaagagcggccatcatttcattgttgcggcgaatgttttcgagtcgtttgcgttcgta |
48412624 |
T |
 |
| Q |
260 |
ctcagtgagtttctgaggcgccatt |
284 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48412625 |
ctcagtgagtttctgaggcgccatt |
48412649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 7 - 84
Target Start/End: Original strand, 48412372 - 48412449
Alignment:
| Q |
7 |
ctgataacaattggggtttcggttttgggttttttctctgatttcacgctatacgatttggtaacggccctgtcaatt |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48412372 |
ctgataacaattggggtttcggttttgggttttttctcagatttcacgctatacgatttggtaacggccctgtcaatt |
48412449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 313 - 353
Target Start/End: Original strand, 48412678 - 48412718
Alignment:
| Q |
313 |
gaaattagggatttgggttttccgaattggattggaatagt |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48412678 |
gaaattagggatttgggttttccgaattggattggaatagt |
48412718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 207 - 259
Target Start/End: Original strand, 48420351 - 48420403
Alignment:
| Q |
207 |
gcggccatcatttcattgttgcggcgaatgttttcgagtcgtttgcgttcgta |
259 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||| ||||| || |||||||| |
|
|
| T |
48420351 |
gcggacatcatttctttgttgcgacgaatgttttcaagtcgcttccgttcgta |
48420403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University