View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13706_high_21 (Length: 316)
Name: NF13706_high_21
Description: NF13706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13706_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 40 - 300
Target Start/End: Original strand, 31602132 - 31602392
Alignment:
| Q |
40 |
tgtgggaaatatagcatgggagacaatgatgaggacattggtnnnnnnnnnnnnncaacgagcaacttctaaatttgcacgagaaaaattgagttctcac |
139 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31602132 |
tgtgagaaatatagcatgggagacaatgatgaggacattggtaaaaaagaaaaaacaacgagcaacttctaaagttgcacgagaaaaattgagttctcac |
31602231 |
T |
 |
| Q |
140 |
tagtgatgccttagcaatagcatatgttttgccgtgttttggacaagcacaaaagtctggaattttgcgaggacagtacgttaagtttgaaaatcatgga |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31602232 |
tagtgatgccttagcaatagcatatgttttgccgtgttttggacaagcacaaaagtctggaattttgcgaggacagtacgttaagtttgaaaatcatgga |
31602331 |
T |
 |
| Q |
240 |
tgatatgtccaaactaagactacgaaactggtcttttatcagagtgaaggtggttttaaac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31602332 |
tgatatgtccaaactaagactacgaaactggtcttttatcagagtgaaggtggttttaaac |
31602392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University