View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13706_high_28 (Length: 276)
Name: NF13706_high_28
Description: NF13706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13706_high_28 |
 | |
|
| [»] scaffold0702 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 36174515 - 36174282
Alignment:
| Q |
1 |
tggcaaaccaaaatatgttaatttctattcatagtagaagactgattcttggaccaaaatattcagtaatagtataaattctagtatttaattaactagt |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36174515 |
tggcaaaccaaaagatgttaatttctattcatagtagaagattgattcttggaccaaaatattcagtaatagtataaattctagtatttaattaactagt |
36174416 |
T |
|
| Q |
101 |
ttgcagtgaaattggaaagctcgaaatgcttggtgtgttggaaaatagtctttttcagttttaggattcagtaatagtataagttctacgcnnnnnnntg |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36174415 |
ttgcggtgaaattggaaagctcgaaatgcttggtgtgttggaaaatagtctttttcagttttaggattcagtaatagtataagttctacgc-aaaaaata |
36174317 |
T |
|
| Q |
201 |
caacattaggatggctgacaatatattaagcatca |
235 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36174316 |
caacattaggatgactgacaatatattaagcatca |
36174282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0702 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0702
Description:
Target: scaffold0702; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 199 - 259
Target Start/End: Original strand, 1740 - 1800
Alignment:
| Q |
199 |
tgcaacattaggatggctgacaatatattaagcatcacgtcatcgctcttttgttacataa |
259 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||||| ||||||||| |||||| |
|
|
| T |
1740 |
tgcaacattaggatgactcacaatatattaagtgtcacgtcatcactcttttgtcacataa |
1800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 199 - 259
Target Start/End: Complemental strand, 2376689 - 2376629
Alignment:
| Q |
199 |
tgcaacattaggatggctgacaatatattaagcatcacgtcatcgctcttttgttacataa |
259 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||||| ||||||||| |||||| |
|
|
| T |
2376689 |
tgcaacattaggatgactcacaatatattaagtgtcacgtcatcactcttttgtcacataa |
2376629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University