View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13706_high_37 (Length: 226)
Name: NF13706_high_37
Description: NF13706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13706_high_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 29 - 220
Target Start/End: Complemental strand, 40551406 - 40551215
Alignment:
| Q |
29 |
tccaagtcagacagcacctagtaatcttcgagcaacttctccctcgtatgctcatgtctcactctggcaaagac-gccatgctatcagtctgatccacaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40551406 |
tccaagtcagacagcacctagtaatcttcgagcaccttctccctcgtatgctcatgtctcactctggcaaagaccgccatgctatcagtctgatccacaa |
40551307 |
T |
 |
| Q |
128 |
aatgagacgccagcctgatagtgcaggcaggttagcctctcctaacttacctgtctctggtttacttgggaatgttagcaatcaatctactat |
220 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40551306 |
aatgggacgccagcctgatagtgcaggcaggttagcctctcctaacttacctgtctctgg-ttacttgggaatgttagcaatcaatctactat |
40551215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 5 - 165
Target Start/End: Complemental strand, 40568628 - 40568468
Alignment:
| Q |
5 |
tttcaatcctcttcaacgcgggattccaagtcagacagcacctagtaatcttcgagcaacttctccctcgtatgctcatgtctcactctggcaaaga-cg |
103 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| | ||||||||| || |
|
|
| T |
40568628 |
tttcaatccccttcaacgtgggattccaagtcagacagcagctagtaatcttcgagcaacttctccctcatatgctcatgtctcgccttggcaaagaccg |
40568529 |
T |
 |
| Q |
104 |
ccatgctatcagtctgatccacaaaatgagacgccagcctgatagtgcaggcaggttagcct |
165 |
Q |
| |
|
||| ||||||||||| |||||| ||||| |||||| |||||| ||||||||||||| ||||| |
|
|
| T |
40568528 |
ccaagctatcagtctaatccac-aaatgggacgccggcctgacagtgcaggcaggtcagcct |
40568468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University