View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13706_high_40 (Length: 205)
Name: NF13706_high_40
Description: NF13706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13706_high_40 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 18 - 114
Target Start/End: Original strand, 7904405 - 7904503
Alignment:
| Q |
18 |
atgacaatcaatatcaagatgtttcgttcattcatacaacacggggtttgtggc--tatgtaacgcgctctggttgtcacaatatagaatggacaaacg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||||| ||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7904405 |
atgacaatcaatatcaagatgtttcgttcgttcatagaacacggggtttgcggcgatatgtaacgcactctggttgtcacaatatagaatggacaaacg |
7904503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 146 - 186
Target Start/End: Original strand, 7904504 - 7904544
Alignment:
| Q |
146 |
tatgtgagccattggagtttgcgggtggctgatgctaaagc |
186 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
7904504 |
tatgtgagccattggagttcgcggatggctgatgctaaagc |
7904544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University