View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13706_low_12 (Length: 424)
Name: NF13706_low_12
Description: NF13706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13706_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 18 - 163
Target Start/End: Original strand, 26798094 - 26798239
Alignment:
| Q |
18 |
aatatcatcattgtcctttacaccattggcgaaaatacttgtatacacatacaaaggtgatgttcctaggtctccatacacaattcccatgctttgaaac |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26798094 |
aatatcatcgttgtcctttacaccattggcgaaaatacttgtatacacatacaaaggtgatgttcctaggtctccatacacaattcccatgctttgaaac |
26798193 |
T |
|
| Q |
118 |
gctagttgcataatcactgccatcgatggccccttaaatttacaaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26798194 |
gctagttgcataatcactgccatcgatggccccttaaatttacaaa |
26798239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 240 - 405
Target Start/End: Original strand, 26798314 - 26798487
Alignment:
| Q |
240 |
ctttactttagaagcatgtgatgaagaaggtaagctgcgtgattccatgtcaagagaatcgcgtttttgggttgaaaaatgagaatgatcataaactcga |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26798314 |
ctttactttagaagcatgtgatgaagaaggtaaactgcgtgattccatgtcaagagaatcacgtttttgggttgaaaaatgagaatgatcataaactcga |
26798413 |
T |
|
| Q |
340 |
ttgtcatgatgattatgctctgtgctg--------ctcctcttttatcactactttaggttcagaagacatttt |
405 |
Q |
| |
|
|||||||||||||||||||| ||| || ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26798414 |
ttgtcatgatgattatgctccgtgttgttatcttcctcctcttttatcacaactttaggttcagaagacatttt |
26798487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University