View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13706_low_19 (Length: 395)
Name: NF13706_low_19
Description: NF13706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13706_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 18 - 379
Target Start/End: Complemental strand, 30040361 - 30040012
Alignment:
| Q |
18 |
atgaaaccgaacactacataaaaagggtgagaaacgaatcgaagggaatagctttgtaactttcagatgcgtgcattttgcattaaaacaggtagggata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30040361 |
atgaaaccgaacactacataaaaagggtgagaaacaaatcgaagggaatagc------------agatgcgtgcattttgcattaaaacaggtagggata |
30040274 |
T |
 |
| Q |
118 |
atagcatagtcataataatccaaagagattctctgcatccattgcaatggctcttcaatcacacaactttgcaaagagtgtccacattaaacgtgcggat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30040273 |
atagcatagtcataataatccaaagagattctctgcatccattgcaatggctcttcaatcacacaactttgcaaagagtgtccacattaaacgtgcggat |
30040174 |
T |
 |
| Q |
218 |
taaacttcaaaggcctcaaactcatctgtcagggacctaatcattttgnnnnnnnnttcaacattaacatacatcctccaaagcctcccattatcaaaga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30040173 |
taaacttcaaaggcctcaaactcatctgtcagggacctaatcattttgaaaaaaaattcaacattaacatacatcctccaaagcctcccattatcaaaga |
30040074 |
T |
 |
| Q |
318 |
agtgatatcgagccctccttttgctaattgtatcaaatgcaacacagacggagcatcaaact |
379 |
Q |
| |
|
|||||||| |||||||||| |||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
30040073 |
agtgatatggagccctcctattgctaatcggatcaaatgcaacacagacggagcatcaaact |
30040012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University