View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13706_low_22 (Length: 322)
Name: NF13706_low_22
Description: NF13706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13706_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 319
Target Start/End: Original strand, 34862323 - 34862641
Alignment:
| Q |
1 |
aaaatgaacacattattgtctctgatgatgaaacagaagatgcagaagcacctttcatccaaaagctctttggaattctcagaatatactttgtgtttct |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34862323 |
aaaatgaccacattattgtctctgatgatgaaacagaagatgcagaagcacctttcatccaaaagctctttggaattctcagaatatactttgtgtttct |
34862422 |
T |
 |
| Q |
101 |
tgaatccattcggcgcgtttcactcggaattttggctggtgtcttcattcatacacgatcacgatcgtctaagagtccaatcattattatgctatctata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34862423 |
tgaatccattcggcgcgtttcactcggaattttggctggtgtcttcattcatacacgatcacaatcgtctaagagtccaatcattattatgctatctata |
34862522 |
T |
 |
| Q |
201 |
acctcttttatgctatttttcatggtgctaaagaagccttttataaagaaaaaggttcaattagttgaaatcatctcactcacatgcgaagttgcatttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34862523 |
acctcttttatgctatttttcatggtgctaaagaagccttttataaagaaaaaggttcaattagttgaaatcatctcactcacatgcgaagttgcatttt |
34862622 |
T |
 |
| Q |
301 |
tcgctacttgttctgtgct |
319 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
34862623 |
tcgctacttgttttgtgct |
34862641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University