View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13706_low_30 (Length: 282)
Name: NF13706_low_30
Description: NF13706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13706_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 41981104 - 41980838
Alignment:
| Q |
1 |
ctcgtcctccttccttcgatgtcgcactctcctccaccatcattttcaactggcgttctccctggcctgaatccacagcacgcgacggcgcttatgctga |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41981104 |
ctcgtcctccttccttcgacgtcgcactctcctccaccatcattttcaactggcgttctccctggcctgaatccacagcacgcgacggcgcttatgctga |
41981005 |
T |
|
| Q |
101 |
tcttttcgcttttcttcacactccctccgccgctgatctttgcttctatggcttcgctaccgatgctccgatcatctcatcaatcgaactcattcctgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41981004 |
tcttttcgcttttcttcacactccctccgccgctgatctttgcttctacggcttcgctaccgatgctccgatcatctcatcaatcgaactcattcctgta |
41980905 |
T |
|
| Q |
201 |
aattccgcttcgtatgattctaactccaccggagaaaacttcattctcgttaactacggtagagttt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41980904 |
aattccgcttcgtatgattctaactccaccggagaaaacttcattctcgttaactacggtagagttt |
41980838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University