View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13706_low_6 (Length: 488)
Name: NF13706_low_6
Description: NF13706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13706_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 435; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 435; E-Value: 0
Query Start/End: Original strand, 29 - 471
Target Start/End: Complemental strand, 31960044 - 31959602
Alignment:
| Q |
29 |
ggcttatcaccggcttgactcaaagcagaagcttccagtgcctctccaatggttatagcattcttgtccaaaaccaaaccaggatcattcataggcacat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31960044 |
ggcttatcaccggcttgactcaaagcagaagcttccagtgcctctccaatggttatagcattcttgtccaaaaccaaaccaggatcattcataggcacat |
31959945 |
T |
|
| Q |
129 |
caggttcaacaaactgtccaacaacttgtgatccaacagattctgtgatcacacggtttgcacccactttggttttggagacactcatgccttggttttt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31959944 |
caggttcaacaaactgtccaacaacttgtgatccaacagattctgtgatcacacggtttgcacccactttggttttggagacactcatgccttggttttt |
31959845 |
T |
|
| Q |
229 |
tgctatgtctgagatgtcttcgtggcttacgaggccggcagcggtgtttactgcagctgctgattgcatcacggaggctggactgcccttttgggtttgt |
328 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31959844 |
tgctatgtctgagatgtctccgtggcttacgaggccggcagcggtgtttactgcagctgctgattgcatcacggaggctggactgcccttttgggtttgt |
31959745 |
T |
|
| Q |
329 |
cctagggcttgattctctgtggcttgcatgagagctgcgtctcttggtttgattggttgtgaggctaattcaccagagacgttgaaaacgtcaccatatt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31959744 |
cctagggcttgattctctgtggcttgcatgagagctgcgtctcttggtttgattggttgtgaggctaattcaccagagacgttgaaaacgtcaccatatt |
31959645 |
T |
|
| Q |
429 |
tgatgggttcttgctcggagaattgttctgcttgtggtctctg |
471 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31959644 |
tgatgggttcttgctcggagaattgctctgcttgtggtctctg |
31959602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 392 - 441
Target Start/End: Original strand, 11248026 - 11248075
Alignment:
| Q |
392 |
gctaattcaccagagacgttgaaaacgtcaccatatttgatgggttcttg |
441 |
Q |
| |
|
||||| ||||| ||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
11248026 |
gctaagtcaccggagacattgaaaacttcaccgtatttgatgggttcttg |
11248075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University