View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13707_low_12 (Length: 225)

Name: NF13707_low_12
Description: NF13707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13707_low_12
NF13707_low_12
[»] chr8 (1 HSPs)
chr8 (14-205)||(29234333-29234524)
[»] chr3 (1 HSPs)
chr3 (50-122)||(43814739-43814812)


Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 205
Target Start/End: Complemental strand, 29234524 - 29234333
Alignment:
14 aatatcataaggtttaatttggagaacaattaaatctaatattggtttgtggttaagtttcttgttttagaagataaaaatagtcagagcaaagatttaa 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29234524 aatatcataaggtttaatttggagaacaattaaatctaatattggtttgtggttaagtttcttgttttagaagataaaaatagtcagagcaaagatttaa 29234425  T
114 ataaatgaaatcgaaattgctacgttggatatatatgtatgtatgtatgtacgatttttgtgattgcatacctcatgttcaatggtattgct 205  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
29234424 ataaatgaaatcgaaattgctacgttggatatatatgtatgtatatatgtacgatttttgtgattgcatacctcatgttcaatggtattgct 29234333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 50 - 122
Target Start/End: Original strand, 43814739 - 43814812
Alignment:
50 taatattggtttgtggttaagtttcttgttttagaagataaaaat-agtcagagcaaagatttaaataaatgaa 122  Q
    |||| |||||||||| |||||||| ||| | |||||||||||||| |||  |||||||||| ||||||||||||    
43814739 taatgttggtttgtgtttaagttttttgctatagaagataaaaataagttggagcaaagatataaataaatgaa 43814812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University