View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13708_high_16 (Length: 201)
Name: NF13708_high_16
Description: NF13708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13708_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 47 - 189
Target Start/End: Original strand, 37472040 - 37472182
Alignment:
| Q |
47 |
actgaaacacgtcattcatttttgtgttccgtttctgcacttatttcaaggtttcttatgcggacttttatgaacacttcgaagcttggtgcaagaaata |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37472040 |
actgaaacacgtcattcatttttgtgttccgtttctgcacttatttcaaggtttctgatgcggacttttatgaacactttgaagcttggtgcaagaaata |
37472139 |
T |
|
| Q |
147 |
tggcaaaacatactcctcagaggaacataaacgccacaggttc |
189 |
Q |
| |
|
|| |||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
37472140 |
tgtcaaaacatactcctaagaggaacataaacgctacaggttc |
37472182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 37469930 - 37469964
Alignment:
| Q |
18 |
tttacaattgcagttggacacggtgttaaactgaa |
52 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37469930 |
tttacaattgcagttggacacagtgttaaactgaa |
37469964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 62; Significance: 5e-27; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 104 - 189
Target Start/End: Complemental strand, 33003919 - 33003834
Alignment:
| Q |
104 |
atgcggacttttatgaacacttcgaagcttggtgcaagaaatatggcaaaacatactcctcagaggaacataaacgccacaggttc |
189 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
33003919 |
atgccgacttttatgaacacttcgaaacttggtgcaagaaatatggaaaaacatactcttcagaggaacataaacgctataggttc |
33003834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University