View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13708_low_14 (Length: 312)
Name: NF13708_low_14
Description: NF13708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13708_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 11 - 296
Target Start/End: Original strand, 46785076 - 46785361
Alignment:
| Q |
11 |
taatacttgaatgtgttttggagacaaaccgtgagacgaatttattgaatttaattcagggtcagtttcagaggtgggttctacgtatcaaaccaattac |
110 |
Q |
| |
|
|||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46785076 |
taatgcttgactgtgttttggggacaaaccgtgagacgaatttattgaatttaattcagggtcagtttcagaggtgggttctacgtatcaaaccaattac |
46785175 |
T |
 |
| Q |
111 |
cctacgttgtgaccacccttttttaaggtatgttttagacttaatatttcacaatcaaaacatatataaatggatatattgtttcctaaactaaattatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46785176 |
cctacgttgtgaccacccttttttaaggtatgttttagacttaatatttcacaatcaaaacatatataaatggatatattgtttcctaaactaaattatg |
46785275 |
T |
 |
| Q |
211 |
ttttgattgctataactagattgaaattgtccatgttcgttgagaatataatttacaattttccttaagatattgctctataaact |
296 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46785276 |
ttttgattgctataactagattgatattgtccatgttcgttgagaatataatttacaattttccttaagatattgctctataaact |
46785361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University