View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13708_low_18 (Length: 273)
Name: NF13708_low_18
Description: NF13708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13708_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 35 - 249
Target Start/End: Complemental strand, 9938983 - 9938768
Alignment:
| Q |
35 |
aatatcgggagaaagaaatatgttcgagctgcaaatttgtttgtaataca-agttcaaaaatatcctcccctcaattacattttccgaataaagattaca |
133 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9938983 |
aatatcgggagaaagaaatatgtttgagctgcaaatttgtttgtaatacgcagtccaaaaatatcctcccctcaattacatttttcgaataaagattaca |
9938884 |
T |
 |
| Q |
134 |
tgggaatagactggttagaggacaactcaatggtcgaccaagaaagttacatacatcattttcagcacgcctataagcaactaagacatccagactcaac |
233 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9938883 |
tgggaatagaccagttagaggacaactcaatggtcgaccaagaaagttacatacatcattttcagcacgcctataagcaactaaggcatccagactcaac |
9938784 |
T |
 |
| Q |
234 |
tttgttaccatattga |
249 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
9938783 |
tttgttaccatattga |
9938768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University