View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13709_high_2 (Length: 548)
Name: NF13709_high_2
Description: NF13709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13709_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 3e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 267 - 391
Target Start/End: Complemental strand, 7308014 - 7307890
Alignment:
| Q |
267 |
atcaatcttttattatggaaatggtgattgagtaattcgaagttgtcatgttgcctctattatgaatagtgttaggatcctcgtatgtgtatggtaagtt |
366 |
Q |
| |
|
||||| |||||||| | |||||||||||||||||| ||||||||||| |||||||| |||||||| ||||| ||||||| ||||||||||||| ||| |
|
|
| T |
7308014 |
atcaagcttttattgtagaaatggtgattgagtaaatcgaagttgtctcattgcctctgttatgaatggtgttgggatccttgtatgtgtatggttggtt |
7307915 |
T |
|
| Q |
367 |
gagattacggtttttggttggattt |
391 |
Q |
| |
|
|||||| |||||||||||| ||||| |
|
|
| T |
7307914 |
gagattgcggtttttggtttgattt |
7307890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 5e-17; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 356 - 405
Target Start/End: Complemental strand, 13245579 - 13245530
Alignment:
| Q |
356 |
tatggtaagttgagattacggtttttggttggatttagctggtttttgag |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13245579 |
tatggtaagttgagattacggtttttggttcgatttagctggtttttgag |
13245530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 495 - 533
Target Start/End: Complemental strand, 13245438 - 13245400
Alignment:
| Q |
495 |
ccatccctgtatttgtggggttagtcttaattccctatg |
533 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13245438 |
ccatccctgtgtttgtggggttagtcttaattccctatg |
13245400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University