View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13709_low_14 (Length: 205)
Name: NF13709_low_14
Description: NF13709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13709_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 186
Target Start/End: Complemental strand, 19190286 - 19190258
Alignment:
| Q |
158 |
tccataaccactgttagatcggttatcaa |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19190286 |
tccataaccactgttagatcggttatcaa |
19190258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University