View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13709_low_14 (Length: 205)

Name: NF13709_low_14
Description: NF13709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13709_low_14
NF13709_low_14
[»] chr5 (1 HSPs)
chr5 (158-186)||(19190258-19190286)


Alignment Details
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 186
Target Start/End: Complemental strand, 19190286 - 19190258
Alignment:
158 tccataaccactgttagatcggttatcaa 186  Q
    |||||||||||||||||||||||||||||    
19190286 tccataaccactgttagatcggttatcaa 19190258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University