View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13709_low_3 (Length: 548)

Name: NF13709_low_3
Description: NF13709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13709_low_3
NF13709_low_3
[»] chr2 (1 HSPs)
chr2 (267-391)||(7307890-7308014)
[»] chr6 (2 HSPs)
chr6 (356-405)||(13245530-13245579)
chr6 (495-533)||(13245400-13245438)


Alignment Details
Target: chr2 (Bit Score: 65; Significance: 3e-28; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 267 - 391
Target Start/End: Complemental strand, 7308014 - 7307890
Alignment:
267 atcaatcttttattatggaaatggtgattgagtaattcgaagttgtcatgttgcctctattatgaatagtgttaggatcctcgtatgtgtatggtaagtt 366  Q
    ||||| |||||||| | |||||||||||||||||| |||||||||||   |||||||| |||||||| ||||| ||||||| |||||||||||||  |||    
7308014 atcaagcttttattgtagaaatggtgattgagtaaatcgaagttgtctcattgcctctgttatgaatggtgttgggatccttgtatgtgtatggttggtt 7307915  T
367 gagattacggtttttggttggattt 391  Q
    |||||| |||||||||||| |||||    
7307914 gagattgcggtttttggtttgattt 7307890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 5e-17; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 356 - 405
Target Start/End: Complemental strand, 13245579 - 13245530
Alignment:
356 tatggtaagttgagattacggtttttggttggatttagctggtttttgag 405  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||    
13245579 tatggtaagttgagattacggtttttggttcgatttagctggtttttgag 13245530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 495 - 533
Target Start/End: Complemental strand, 13245438 - 13245400
Alignment:
495 ccatccctgtatttgtggggttagtcttaattccctatg 533  Q
    |||||||||| ||||||||||||||||||||||||||||    
13245438 ccatccctgtgtttgtggggttagtcttaattccctatg 13245400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University