View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_high_47 (Length: 341)
Name: NF1370_high_47
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_high_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 9 - 313
Target Start/End: Original strand, 3932463 - 3932767
Alignment:
| Q |
9 |
agcagagatggaacgggttgaggagttcaaggttggagattgggttcgtgttcgtccaacccttacaacttcaaagcatggattaggaaatgtggtaccg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3932463 |
agcagagatggaacgggttgaggagttcaaggttggagattgggttcgtgttcgtccaacccttacaacttcaaagcatggattaggaaatgtggtacca |
3932562 |
T |
|
| Q |
109 |
ggaaccattggcattgtatattgtatccgacctgacagtagtttgttagtcgagttgagctatgttcaaaatccatggcattgtgaaccagaggagattg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3932563 |
ggaaccattggcattgtatattgtatccgacctgacagtagtttgttagtcgagttgagctatgttcaaaatccatggcattgtgaaccagaggagattg |
3932662 |
T |
|
| Q |
209 |
agcatgttcctccttttagggtaagaggaatgtagattattttaattctctgacttaatatttttgtcctatttttgttacatgatttgtatttgtctta |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3932663 |
agcatgttcctccttttagggtaagaggaatgtagattattttaattctctgacttaatatttttgtcctatttttgttacatgatttgtatttgtctta |
3932762 |
T |
|
| Q |
309 |
cagat |
313 |
Q |
| |
|
||||| |
|
|
| T |
3932763 |
cagat |
3932767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University