View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_high_58 (Length: 285)
Name: NF1370_high_58
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_high_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 105 - 271
Target Start/End: Complemental strand, 29482022 - 29481856
Alignment:
| Q |
105 |
gcaactccaaatactacaaacccatcacccaccccaccaccatcccttcctccgacgaccgctccgtcatcatcggcgagtccggcgtctcctaccttct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29482022 |
gcaactccaaatactacaaacccatcacccaccccaccaccatcccttcctccgacgaccgctccgtcatcatcggcgagtccggcgtctcctaccttct |
29481923 |
T |
 |
| Q |
205 |
ccctggagctcccttcgagtttcagttcagttactccgaaactccaaaagtaaaaccaattgctatc |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29481922 |
ccctggagctcccttcgagtttcagttcagttactccgaaactccaaaagtaaaaccaattgctatc |
29481856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University