View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_high_59 (Length: 282)
Name: NF1370_high_59
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_high_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 30 - 275
Target Start/End: Original strand, 35648621 - 35648866
Alignment:
| Q |
30 |
ccattgtcatatgttaaatgcattatcaactgttataccttgtaacgtttgatatctactagtagaaattgaactttaacaactgtattggtttgattaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||| ||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35648621 |
ccattgtcatatgttaaatgcattatccactgtcataccttataacgttggatatctactagtggaaattgaactttaataactgtattggtttgattaa |
35648720 |
T |
 |
| Q |
130 |
ctctgtttgtttagttataggagtcactgtcacatgttactaattattctctttcatgcatttctaagacttaaaacatagggttgtgagcagtgcaaac |
229 |
Q |
| |
|
||||||| || ||||||| |||| || ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35648721 |
ctctgttggtgtagttatgggagccagtgtcacatgttgccaattattctctttcatgcatttctaagacttaaaacatagggttgtgagcagtgcaaac |
35648820 |
T |
 |
| Q |
230 |
ccttgttatcatttaactttaaattggtcttctgttatctgtggtg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
35648821 |
ccttgttatcatttaactttaaattggtcttctactatctatggtg |
35648866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University