View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_high_71 (Length: 251)
Name: NF1370_high_71
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_high_71 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 41 - 126
Target Start/End: Original strand, 39272037 - 39272122
Alignment:
| Q |
41 |
cttgttagaagcgctgtatgaaattgaagttacttggtgttttctagtttccttaggagctgcactatctcttagaaaagcaacca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39272037 |
cttgttagaagcgctgtatgaaattgaagttacttggtgttttctagtttccttaggagctgtactatctcttagaaaagcaacca |
39272122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 139 - 175
Target Start/End: Original strand, 39272197 - 39272233
Alignment:
| Q |
139 |
agtttggtcaatggtggctacctctacgattataggg |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39272197 |
agtttggtcaatggtggctacctctacgattataggg |
39272233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University