View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_high_75 (Length: 240)
Name: NF1370_high_75
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_high_75 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 17326211 - 17326038
Alignment:
| Q |
18 |
actctcgtggagatgactttcttggtggattcgctggttgttgttactaagattctgttttgaaacctcgttgtcaatgtattgnnnnnnnnnnnnnnag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| || |
|
|
| T |
17326211 |
actctcgtggagatgactttcttggtggattcgctggttgttgttactaaggttatgttttgaaacctcgttgtcaatgtattgtttctgatttttttag |
17326112 |
T |
|
| Q |
118 |
atttgattttcttcgtgtggggaacaatgggctcgaaaggct---ggtactcactctggtttgttgtgggggtt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17326111 |
atttgattttcttcgtgtggggaacaatgggctcgaaaggctgtcggtactcactctggtttgttgtgggggtt |
17326038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 187 - 240
Target Start/End: Original strand, 3018768 - 3018821
Alignment:
| Q |
187 |
ttcaaagaaacctttgcccctgttgtccgacctcaaaccataaaattaattctt |
240 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3018768 |
ttcaaagaaaccttcgcccctgttgtccgacctcaaaccataaaattaattctt |
3018821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University