View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_low_41 (Length: 380)
Name: NF1370_low_41
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_low_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 30 - 280
Target Start/End: Original strand, 43315808 - 43316058
Alignment:
| Q |
30 |
tgggatgcaaccaatatcctatatggaaagaactttgagaaattttctaataataacaataatcaacaaaaaattaattaataaacagaagccgtgtttg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43315808 |
tgggatgcaaccaatatcctatatggaaagaactttgagaaattttctaataataacaataatcaacaaaaaattaattaataaacagaagccgtgtttg |
43315907 |
T |
 |
| Q |
130 |
tttcatgttcaaaataaagtgcaaaattcattttatggatatgcacaaaacaaggaatatcccaaaacaaccagaaaagtggacctaagagtaatcataa |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43315908 |
tttcatgttcaaaataaagtgcaaaattcattttatggatatgcacaaaacaaggaatatcccaaaacaaccagaaaagtggacctaagagtaataataa |
43316007 |
T |
 |
| Q |
230 |
atttcattttctctttctcaaatagttaaaaatgccttttttcttttctct |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43316008 |
atttcattttctctttctcaaatagttaaaaatgccttttttcttttctct |
43316058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University