View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_low_43 (Length: 375)
Name: NF1370_low_43
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1370_low_43 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 1e-29; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 79 - 244
Target Start/End: Complemental strand, 33496945 - 33496785
Alignment:
Q |
79 |
catttttaactctaaatcactgatctaatttgtttgtcttcgttatatgatttaaataagtaattttcacgtatatttaannnnnnnnnnnnnnnnnnat |
178 |
Q |
|
|
|||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| | ||||| | |||| ||||| || |
|
|
T |
33496945 |
catttttaaccctaaatcaccgatctaatttgtttgtcttcgttatatgatttaaataaatgatttttatgtatgtttaattttctttttttt-----at |
33496851 |
T |
|
Q |
179 |
gatttcactgtattagtggaacaagttgttttattcatcatcttggtgcaacattattttgatttt |
244 |
Q |
|
|
||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
33496850 |
gatttcactttattagtagaacaagttgttttgttcatcatcttggtgcaacattattttgatttt |
33496785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 228 - 331
Target Start/End: Complemental strand, 33496013 - 33495907
Alignment:
Q |
228 |
aacattattttgattttctct---gttatacatcagattgacacactaatttcaattaagtgcaatttaaacaatgacttgatgtcttcgatgctataga |
324 |
Q |
|
|
||||||||||||||||||| | ||| | ||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
T |
33496013 |
aacattattttgattttctgttttgttgtgcatcagattaacatactaatttcaattaagtgcaatttaaacaatgacttgatgtcttcaatgctataaa |
33495914 |
T |
|
Q |
325 |
ctaagaa |
331 |
Q |
|
|
||||||| |
|
|
T |
33495913 |
ctaagaa |
33495907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 329 - 375
Target Start/End: Complemental strand, 33495846 - 33495800
Alignment:
Q |
329 |
gaatacatgtcgttattttagtaaaaaagaaatttatacaactcaaa |
375 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33495846 |
gaatacatgtcgttattttagtaaaaaagaaatttatacaactcaaa |
33495800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7199 times since January 2019
Visitors: 6015