View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_low_48 (Length: 363)
Name: NF1370_low_48
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1370_low_48 |
![](./plan/images/spacer.gif) | ![NF1370_low_48](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 82 - 354
Target Start/End: Complemental strand, 39100485 - 39100210
Alignment:
Q |
82 |
aataaaaacctgatagcagatgatctaattgatattaaagataccattttagaaatgatggtcagacctaacaaaatcccacaaaaccaactttttgaga |
181 |
Q |
|
|
||||||||||||||||||||||| | ||| |||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||| | ||||||| |
|
|
T |
39100485 |
aataaaaacctgatagcagatgacccaatggatattgaagataccattttagaaatggtggtcggacctaacaaaatcccacaaaaccgattttttgaag |
39100386 |
T |
![](./plan/images/spacer.gif) |
Q |
182 |
taagaattacctccacttatacatacacattgtcatgccatcttctatccaatg---gactttcaagatattatgcatccatttaaattaaattaaatta |
278 |
Q |
|
|
|||| ||||||||||||| |||||||||||||||||| |||||| ||||| || ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
39100385 |
taaggattacctccacttgtacatacacattgtcatgtcatcttatatccgattcgagactttcaagacattatgcatccatttaaattaaattaaatta |
39100286 |
T |
![](./plan/images/spacer.gif) |
Q |
279 |
aattgcctcgtattctccagaatttatccactatgtggttttatcattccaatgcctctctgcaaaagctctgtgg |
354 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39100285 |
aattgcctcgtattctccagaatttatccactatgtggttttatcattccaatgcctctctgcaaaagctctgtgg |
39100210 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4922 times since January 2019
Visitors: 1270