View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_low_52 (Length: 341)
Name: NF1370_low_52
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 4e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 122 - 329
Target Start/End: Complemental strand, 40515433 - 40515226
Alignment:
| Q |
122 |
gatgttgcaagaagataacaaacaaaacacaaaatcacagatatatgtaaaagaacaatgcagatgaatgtactaaaacactgatccaaaaccaattatt |
221 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
40515433 |
gatgttgcaacaagataacaaacaaattacaaaatcacagatatatgtaaaagaacgatgcagatgaatgtactaaaacattgatccaaaaccatatatt |
40515334 |
T |
 |
| Q |
222 |
tcttatatatgaagaataacataagatgtaagagagctcgtgttagattaatactttgaattatgaatcagacatacataacggtacgcagcagtagtat |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40515333 |
tcttatatatgaagaataacataagatgtaagagagctcgtgttagattaatactttgaattatgaatcagacatacataacggtacgcagcagtagtat |
40515234 |
T |
 |
| Q |
322 |
agaatatt |
329 |
Q |
| |
|
|||||||| |
|
|
| T |
40515233 |
agaatatt |
40515226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University