View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_low_59 (Length: 332)
Name: NF1370_low_59
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_low_59 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 28139025 - 28138791
Alignment:
| Q |
1 |
tctttttatgtatggatgcatcaacggttgacttttatatttagggagcttctatcagttattgacacctttgggaacaaaaacagggttaaacctgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28139025 |
tctttttatgtatggatgcatcaacggttgacttttatatttagggagcttctatcagttattgacacctttgggaacaaaaacagggttaaacctgtga |
28138926 |
T |
 |
| Q |
101 |
gggttggatctatgttagactctgtcttaaaggaacctactacaagggaagaaagggcctctcagttcaagtcaccaaacacagactcactcttgttgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28138925 |
gggttggatctatgttagactctgtcttaaaggaacctactacaagggaagaaagggcctctcagttcaagtcaccaaacacagactcactcttgttgtc |
28138826 |
T |
 |
| Q |
201 |
cttggattcggggaggcgtttatctccacccttgg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28138825 |
cttggattcggggaggcgtttatctccacccttgg |
28138791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University