View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_low_61 (Length: 315)
Name: NF1370_low_61
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_low_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 35 - 285
Target Start/End: Complemental strand, 33495754 - 33495504
Alignment:
| Q |
35 |
gacacagaaaaaacaaaatcaataaaatagttttggtgggccctaccatttacatatttagtataactgctaagaagtacaataaaccattgaaaagaag |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33495754 |
gacacagaaaaaacaaaatcaataaaatagttttggtgggccctaccatttacatatttagtataactgctaagaagtacaataaaccattgaaaagaag |
33495655 |
T |
 |
| Q |
135 |
tagcagttttannnnnnncgtcggtttgtgccgttgaaccttttttctttataaattgaccacaacctcgtttcttagctagccaagtaaccaagtatga |
234 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33495654 |
tagcagttttatttttttcgtcggtttgtgccgttgaaccttttttctttataaattgaccacaacctcgttccttagctagccaagtaaccaagtatga |
33495555 |
T |
 |
| Q |
235 |
nnnnnnnctcaactttttccttcctataaattcttcattcttcagaataat |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33495554 |
tttttttctcaactttttccttcctataaattcttcattcttcagagtaat |
33495504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University