View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_low_64 (Length: 311)
Name: NF1370_low_64
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_low_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 95 - 218
Target Start/End: Complemental strand, 42931385 - 42931262
Alignment:
| Q |
95 |
tgttattcgtttgtaggggatttttacttgatgaatgatattttataattattgattgatcattaaggatccaattcaatgttgaatagatgttagtctg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42931385 |
tgttattcgtttgtaggggatttttacttgatgaatgatttgttataattattgattgatcattaaggatccaattcaatgttgaatagatgttagtctg |
42931286 |
T |
|
| Q |
195 |
cggtgatgcgataatagtagtgtc |
218 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42931285 |
cggtgatgcgataatagtagtgtc |
42931262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University