View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_low_67 (Length: 291)
Name: NF1370_low_67
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_low_67 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 43727783 - 43727519
Alignment:
| Q |
1 |
aaaaagatggagcaaacaggctgaggaattgcaca---tgaacatccttttgataattatatataaacaggatcgttttgcaagaagacacaagttaact |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
43727783 |
aaaaagatggagcaaacaggctgaggaattgcacacattgaacatccttttgataattatatataaacaggatcgttttgcaaggagacaaaagttaact |
43727684 |
T |
|
| Q |
98 |
tgaagctgcaaactcattcaagcctccattcaatcaaaagacatgtgtttggaggaagtaatattattcatccattctttcagaaagcagttcaggtttc |
197 |
Q |
| |
|
| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43727683 |
ttaagctgcaaactcgttcaagcctccattcaatcaaaagacatgtgtttggaggaagtaatattattcatccattctttcagaaagcagttcaggtttc |
43727584 |
T |
|
| Q |
198 |
agtacagtgaattcgaaccttatacatatggttgtgtttcgttagttgagtgattacggtgcagt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43727583 |
agtacagtgaattcgaaccttatacatatggttgtgtttcgttagttgagtgattaccgtgcagt |
43727519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University