View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_low_71 (Length: 276)
Name: NF1370_low_71
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_low_71 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 50 - 267
Target Start/End: Complemental strand, 52150413 - 52150196
Alignment:
| Q |
50 |
ttacattaggttacattgaaattgtgcaaatcttgcagcctctcgcgtgtttttgacctatctccatatttcaaacttggaaatggctttaccttcctcc |
149 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52150413 |
ttacattaggttacatcgaaattgtgcaaatcttgcagcctctcgcgtgtttttgacctatctccatatttcaaacttggaaatggctttaccttcctcc |
52150314 |
T |
 |
| Q |
150 |
tccaagtccaaattaaccatgacgcttatcattcacacaaagaaggagaaagttctctttgctgaaacatcaaaacctgtagtagatattcttctccaca |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52150313 |
tccaagtccaaattaaccatgacgcttatcattgacacaaagaaggagaaagttctctttgctgaaacatcaaaacctgtagtagatattcttctccaca |
52150214 |
T |
 |
| Q |
250 |
tgtcaaccttgcctttgg |
267 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
52150213 |
tgtcaaccttgcctttgg |
52150196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 52150613 - 52150560
Alignment:
| Q |
1 |
aacattggattatatccttgcaaagtatgcctagaacaaaataataattttaca |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52150613 |
aacattggattatatccttgcaaagtatgcctagaacaaaatagtaattttaca |
52150560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 184 - 251
Target Start/End: Complemental strand, 52155086 - 52155019
Alignment:
| Q |
184 |
acacaaagaaggagaaagttctctttgctgaaacatcaaaacctgtagtagatattcttctccacatg |
251 |
Q |
| |
|
||||| |||| ||||||||| | ||||||||| |||||||| | ||||||||| |||||||||||||| |
|
|
| T |
52155086 |
acacagagaatgagaaagttgtttttgctgaagcatcaaaatccgtagtagattttcttctccacatg |
52155019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 186 - 235
Target Start/End: Complemental strand, 52145798 - 52145749
Alignment:
| Q |
186 |
acaaagaaggagaaagttctctttgctgaaacatcaaaacctgtagtaga |
235 |
Q |
| |
|
|||||||| ||||||||||||||||||||| | |||||| ||||| |||| |
|
|
| T |
52145798 |
acaaagaatgagaaagttctctttgctgaagcttcaaaatctgtaataga |
52145749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University