View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_low_74 (Length: 256)
Name: NF1370_low_74
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_low_74 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 29 - 246
Target Start/End: Original strand, 28977178 - 28977395
Alignment:
| Q |
29 |
acttatgggtgttgttgctcctacatcttatgcatgtggctattttctcaatctccataaagcaacaggcaatcctgttcttgtttatatggcagctggt |
128 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28977178 |
acttatgggtgttgttgctcctacctcttatgcatgtggctattttctcaatctccataaagcaacaggcaatcctgttcttgtttatatggcagctggt |
28977277 |
T |
 |
| Q |
129 |
aggtttgcttatgaccttgagaagttatctgatgagtcagcagcaaatttcgtgatgttacagcttaagaagatgtttcctgatgcttgtgagccagtaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28977278 |
aggtttgcttatgaccttgagaagttatctgatgagtcagcagcaaattttgtgatgttacagcttaagaagatgtttcctgatgcttgtgagccagtaa |
28977377 |
T |
 |
| Q |
229 |
gttaacctctcatattct |
246 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
28977378 |
gttaacctctcatgttct |
28977395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University