View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_low_80 (Length: 251)
Name: NF1370_low_80
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_low_80 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 32596961 - 32596754
Alignment:
| Q |
1 |
tccatttaactaggagagagggtggacaccttatacactattttataccacagactgagactacatttacaccctttcaagcaactaaacaaggagagag |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
32596961 |
tccatgtaactaggagagagggtggacaccatatacactattttataccacagactgagactacatttacaccctt-caagcaactaaacaaggagacag |
32596863 |
T |
 |
| Q |
101 |
ggtgagaccgtagaatggggtttccagcaaacattatccaacttggtattgagtagacttgacatattttgcaatgtattcttcaagtcgaactcaaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32596862 |
ggtgagaccgtagaatggggtttccagcaaacattatccaacttggtattgagtagacatgacatattttgcaatgtattcttcaagtcgaactcaaaat |
32596763 |
T |
 |
| Q |
201 |
ataacaacg |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
32596762 |
ataacaacg |
32596754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 181
Target Start/End: Complemental strand, 32667189 - 32667147
Alignment:
| Q |
139 |
caacttggtattgagtagacttgacatattttgcaatgtattc |
181 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
32667189 |
caactttgtattgtgtagacttgacatattttgtaatgtattc |
32667147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University