View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_low_85 (Length: 243)
Name: NF1370_low_85
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_low_85 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 83 - 225
Target Start/End: Complemental strand, 37502699 - 37502561
Alignment:
| Q |
83 |
gataattctctggtaataatnnnnnnngaatcgtgggtagtttagctagataaaaacattcacaaaagtaatttttaataacaaaacatgtttattccac |
182 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37502699 |
gataattctccggtaataataaaaaaagaatcgtgggta----agctagataaaaacattcataaaagtaatttttaataacaaaacatgtttattccac |
37502604 |
T |
 |
| Q |
183 |
ttacaaatttacttatgtaggtaattttgattgagtagtcttc |
225 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37502603 |
ttacaaatttactcatgtaggtaattttgattgagtagtcttc |
37502561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University