View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_low_89 (Length: 239)
Name: NF1370_low_89
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_low_89 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 220
Target Start/End: Original strand, 45179387 - 45179596
Alignment:
| Q |
13 |
attatactctggaggt--ctctgaagatttgatccagtcagcatttcaatatcgttattttcattcttggtaatatgaactcagtaattacataaagtga |
110 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
45179387 |
attataccctggaggtgtctctgaagatttgatccagtcagcatttcaatatcgttattttcattcttggaaatatgaactcggtaattacataaagtga |
45179486 |
T |
|
| Q |
111 |
aattgcaatactcaatgcatttgactcacaatatcagagaaaatgtttcaaaggcatgttgccaacctcgtctgtgaacccatggaagtaattacatatt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45179487 |
aattgcaatactcaatgcatttgactcacaatatcagagaaaatgtttcaaaggcatgttgccaacctcttctgtgaacccatggaagtaattacatatt |
45179586 |
T |
|
| Q |
211 |
aaacacatga |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
45179587 |
aaacacatga |
45179596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 21 - 75
Target Start/End: Original strand, 45172576 - 45172630
Alignment:
| Q |
21 |
ctggaggtctctgaagatttgatccagtcagcatttcaatatcgttattttcatt |
75 |
Q |
| |
|
||||||| |||||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
45172576 |
ctggagggctctgaagatctgatccagttggcatttcaatatcgttgttttcatt |
45172630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University