View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_low_92 (Length: 225)
Name: NF1370_low_92
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_low_92 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 12 - 145
Target Start/End: Complemental strand, 4122830 - 4122697
Alignment:
| Q |
12 |
ttgaggactctccgaatcatccatattgttgctctttttaattatatcagaatgtaccattttttatgacaaaataggctgctgccgataaagcatttgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4122830 |
ttgaggactctccgaatcatccatattgttgctctttttaattatatcagaatgtaccattttttatgacaaaataggctgctgccgataaagcatttgt |
4122731 |
T |
 |
| Q |
112 |
tgaaccagagaaatggatcaagatgagtattctc |
145 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
4122730 |
tgaaccagagaagtggatcaagatgagtattctc |
4122697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University