View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1370_low_93 (Length: 218)
Name: NF1370_low_93
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1370_low_93 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 39 - 197
Target Start/End: Original strand, 40283741 - 40283899
Alignment:
| Q |
39 |
gatgcagcagcagcactgtgtctcggtctactaagtccgaatacatagtgccgatgtgataagatatggatatgttgaattttttaaattcaagatagaa |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40283741 |
gatgcagcagcagcactgtgtctcggtctactaagtccgaatacatagtgccgatgtgataagatatggatatgttaaattttttaaattcaagatagaa |
40283840 |
T |
 |
| Q |
139 |
cctatataggttaataagttttttataatgagttttttattagatttctacgtacattt |
197 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40283841 |
cctatatacgttaacaagttttttataatgagttttttattagatttctacgtacattt |
40283899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University