View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1370_low_93 (Length: 218)

Name: NF1370_low_93
Description: NF1370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1370_low_93
NF1370_low_93
[»] chr7 (1 HSPs)
chr7 (39-197)||(40283741-40283899)


Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 39 - 197
Target Start/End: Original strand, 40283741 - 40283899
Alignment:
39 gatgcagcagcagcactgtgtctcggtctactaagtccgaatacatagtgccgatgtgataagatatggatatgttgaattttttaaattcaagatagaa 138  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
40283741 gatgcagcagcagcactgtgtctcggtctactaagtccgaatacatagtgccgatgtgataagatatggatatgttaaattttttaaattcaagatagaa 40283840  T
139 cctatataggttaataagttttttataatgagttttttattagatttctacgtacattt 197  Q
    |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
40283841 cctatatacgttaacaagttttttataatgagttttttattagatttctacgtacattt 40283899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University