View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1371-INSERTION-3 (Length: 109)
Name: NF1371-INSERTION-3
Description: NF1371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1371-INSERTION-3 |
 | |
|
| [»] scaffold0155 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0155 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: scaffold0155
Description:
Target: scaffold0155; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 6 - 109
Target Start/End: Complemental strand, 25901 - 25798
Alignment:
| Q |
6 |
cagacatggcttcacaaataggttttgttatgcaacacattgatgattgtattgatagtctgcataaaaatgatatatgcccaatactcgcaaaagatgt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| ||||| |
|
|
| T |
25901 |
cagacatggcttcacaaataggttttgttatgcaacacattgatgattgtattgatagtctgcataaaaatgatactagcccaatacttgcaaaggatgt |
25802 |
T |
|
| Q |
106 |
tgat |
109 |
Q |
| |
|
|||| |
|
|
| T |
25801 |
tgat |
25798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 33928 times since January 2019
Visitors: 1229