View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13710_high_1 (Length: 444)
Name: NF13710_high_1
Description: NF13710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13710_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 400; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 19 - 434
Target Start/End: Complemental strand, 48669187 - 48668772
Alignment:
| Q |
19 |
gtgcttccttctttgctcttctcaacaacttcatacatggaagagtggtcatacctgacaggggttctcaatcttttataagtacaattggtcacttaga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48669187 |
gtgcttccttctttgctcttctcaacaacttcatacatggaagagtggtcatacccgacaggggttctcaatcttttgtaagtacaattggtcacttaga |
48669088 |
T |
 |
| Q |
119 |
cgccaggcttgatcttcaaaccacaaatggaaatggagccttccaaccacacatgggaaaccgtgctttaatggatctctgcattatgtcttccaagata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669087 |
cgccaggcttgatcttcaaaccacaaatggaaatggagccttccaaccacacatgggaaaccgtgctttaatggatctctgcattatgtcttccaagata |
48668988 |
T |
 |
| Q |
219 |
gcatatgagaaccctaaactcatcaaaaatgtcgtcaaccaccattggaacatgcactttgtagatttctatcattgttggaatggtatgttgcattatc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48668987 |
gcatatgagaaccctaaactcatcaaaaatgtcgtcaaccaccattggaacatgcactttgtagatttctatcattgttggaatggtatgttgcattatc |
48668888 |
T |
 |
| Q |
319 |
tacaatcataattaatgatttcattcaattcaacttttctcacttcctaatccttccttcatcaatcaattcttagatttcgagaaacagatgtccactc |
418 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48668887 |
tacaatcataattaattatttcattcaattcaacttttctcacttcctattccttccttcatcaatcaattcttagatttcgagaaacagatgtccactc |
48668788 |
T |
 |
| Q |
419 |
aagtcttcatcctatg |
434 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
48668787 |
aagtcttcatcctatg |
48668772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University