View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13710_high_10 (Length: 205)
Name: NF13710_high_10
Description: NF13710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13710_high_10 |
 |  |
|
| [»] scaffold0008 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0008 (Bit Score: 72; Significance: 6e-33; HSPs: 3)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 16 - 102
Target Start/End: Original strand, 267182 - 267266
Alignment:
| Q |
16 |
ggaatatctttggtcaaagtctcgttatttaacacacaaaaaatatatgtttataattaagtttgcaagtgtttctaactgcaatcc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
267182 |
ggaatatctttggtcaaagtctcgttatttaacac--aaaaaatatatgtttataattaagtttgcaagtgttcctaactgcaatcc |
267266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 24 - 116
Target Start/End: Original strand, 241234 - 241326
Alignment:
| Q |
24 |
tttggtcaaagtctcgttatttaacacacaaaaaatatatgtttataattaagtttgcaagtgtttctaactgcaatccatatatcagaacaa |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||| |||||||||||||||||||||||| |||| |||||| ||||||| ||||||| |
|
|
| T |
241234 |
tttggtcaaagtctcgttatttaatacacaaatggtatatttttataattaagtttgcaagtgttcctaagtgcaattcatatataagaacaa |
241326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 121 - 165
Target Start/End: Original strand, 267268 - 267312
Alignment:
| Q |
121 |
atgttataaatttacgaaaattttatggtgaagtcatgaaaatta |
165 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
267268 |
atgttataaatttaggaaaattctatggtgaagtcatgaaaatta |
267312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University