View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13710_high_5 (Length: 248)
Name: NF13710_high_5
Description: NF13710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13710_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 22046887 - 22046651
Alignment:
| Q |
1 |
tggttagttactttttatatctcaaactggtaattttacattcacagttcttcattttatttttcgtttatggttctatttgcagacattgaagaaggaa |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22046887 |
tggttagttagtttttatatctcaaactggtaattttacattcacaattcttcattttatttttcgtttatgcttctatttgcagacattgaagaaggaa |
22046788 |
T |
|
| Q |
101 |
tttgcaaactatattagaacttctaaatatgattatgtggaaatgtatggaccagaaggcatgaaagttgatgtcaagattcttaagagnnnnnnnnnnn |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22046787 |
tttgcaaactatattagaacttctaaatatgattatgtggaaatgtatggaccagaaggcatggaagttgatgtcaagattcttaagagaaaaaaaggaa |
22046688 |
T |
|
| Q |
201 |
nnnggacatggactgagtttggagatcactggaatat |
237 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |
|
|
| T |
22046687 |
aaaggtcatggactgagtttggagatcactggaatat |
22046651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University