View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13710_high_9 (Length: 213)
Name: NF13710_high_9
Description: NF13710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13710_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 17 - 121
Target Start/End: Original strand, 40195074 - 40195175
Alignment:
| Q |
17 |
caaagggctattaattgagtgacaataagagcgcgagtgtatctatgtgttgttttgatttccccaattcaacgcccaac-tagtgatgagtgtcgacgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40195074 |
caaagggctattaattgagtgacaataagagcgcgagtg----tatgtgttgttttgatttccccaattcaacgcccaacttagtgatgagtgtcgacgt |
40195169 |
T |
 |
| Q |
116 |
tacacg |
121 |
Q |
| |
|
|||||| |
|
|
| T |
40195170 |
tacacg |
40195175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University