View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13710_low_9 (Length: 213)

Name: NF13710_low_9
Description: NF13710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13710_low_9
NF13710_low_9
[»] chr7 (1 HSPs)
chr7 (17-121)||(40195074-40195175)


Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 17 - 121
Target Start/End: Original strand, 40195074 - 40195175
Alignment:
17 caaagggctattaattgagtgacaataagagcgcgagtgtatctatgtgttgttttgatttccccaattcaacgcccaac-tagtgatgagtgtcgacgt 115  Q
    |||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
40195074 caaagggctattaattgagtgacaataagagcgcgagtg----tatgtgttgttttgatttccccaattcaacgcccaacttagtgatgagtgtcgacgt 40195169  T
116 tacacg 121  Q
    ||||||    
40195170 tacacg 40195175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University