View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13711_high_13 (Length: 358)
Name: NF13711_high_13
Description: NF13711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13711_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 129 - 337
Target Start/End: Complemental strand, 21742609 - 21742407
Alignment:
| Q |
129 |
tagaatatggtttaggtgcatatgcatttggtattttctacctcacttcatttcaannnnnnnaatgcaaaaataattgaagggccaaatttgactataa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21742609 |
tagaatatggtttaggtgcatatgcatttggtattttctacctcacttcatttcaatttttttaatgcaaaaataattgaagggccaaatttgactataa |
21742510 |
T |
 |
| Q |
229 |
gttagtgttacatcaaatatggtgatgaaaaggcatgaatgtagtgactgtatatgaccttgactgtacctaatcctaatctaaattattggttgtaact |
328 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21742509 |
gtta------catcaaatatggtgatgaaaaggcatgactgtagtgcctgtatatgaccttgactgtacctaatcctaatctaaatcattggttgtaact |
21742416 |
T |
 |
| Q |
329 |
tgtgagtca |
337 |
Q |
| |
|
||||||||| |
|
|
| T |
21742415 |
tgtgagtca |
21742407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 48
Target Start/End: Complemental strand, 21742667 - 21742638
Alignment:
| Q |
19 |
cttcagcataacattaattcagatgtacat |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21742667 |
cttcagcataacattaattcagatgtacat |
21742638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University