View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13711_high_26 (Length: 269)
Name: NF13711_high_26
Description: NF13711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13711_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 87 - 247
Target Start/End: Complemental strand, 35704866 - 35704704
Alignment:
| Q |
87 |
tatatcacatgtaccatatcattctatttatttgttctcgtgagcttagctcttcaaactccgaccatnnnnnnnnn--tcattctatctatttatttat |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| || |||| ||||||||||||||||||| | |
|
|
| T |
35704866 |
tatatcacatgtaccatatcattctatttatttgtcctcgtgagcttaactcttcaaaccccaaccaccacaaaaaaaatcattctatctatttatttct |
35704767 |
T |
 |
| Q |
185 |
cttaattattatgcaccaacaatttttagataaattatgccggcatccatccaataatataca |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35704766 |
cttaattattatgcaccaacaatttttagataaattatgccggcatccatccaataatataca |
35704704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University