View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13711_high_37 (Length: 215)

Name: NF13711_high_37
Description: NF13711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13711_high_37
NF13711_high_37
[»] chr3 (1 HSPs)
chr3 (17-215)||(48542306-48542510)


Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 215
Target Start/End: Original strand, 48542306 - 48542510
Alignment:
17 gtggatgagaacgagagaaggtttttgtgtggatttgtttgttggtccccaaaaatggagagatgtttcgttgtc------gatgtcgattacttgagat 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      |||||||||| ||||||||    
48542306 gtggatgagaacgagagaaggtttttgtgtggatttgtttgttggtccccaaaaatggagagatgtttcgttgtcgatgtcgatgtcgatttcttgagat 48542405  T
111 aagagaccggcgccggtgaaacaacggcggaggtagccgttgtataagccggcgaaactaagaaacgaggaaatcatgattatgattaattaattattgg 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||    
48542406 aagagaccggcgccggtgaaacaacggcggaggtagccgttgtataagccggcgaaactaagaaacgatggaatcatgattatgattaattaattattgg 48542505  T
211 atcat 215  Q
    |||||    
48542506 atcat 48542510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University