View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13711_high_37 (Length: 215)
Name: NF13711_high_37
Description: NF13711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13711_high_37 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 215
Target Start/End: Original strand, 48542306 - 48542510
Alignment:
| Q |
17 |
gtggatgagaacgagagaaggtttttgtgtggatttgtttgttggtccccaaaaatggagagatgtttcgttgtc------gatgtcgattacttgagat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
48542306 |
gtggatgagaacgagagaaggtttttgtgtggatttgtttgttggtccccaaaaatggagagatgtttcgttgtcgatgtcgatgtcgatttcttgagat |
48542405 |
T |
 |
| Q |
111 |
aagagaccggcgccggtgaaacaacggcggaggtagccgttgtataagccggcgaaactaagaaacgaggaaatcatgattatgattaattaattattgg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
48542406 |
aagagaccggcgccggtgaaacaacggcggaggtagccgttgtataagccggcgaaactaagaaacgatggaatcatgattatgattaattaattattgg |
48542505 |
T |
 |
| Q |
211 |
atcat |
215 |
Q |
| |
|
||||| |
|
|
| T |
48542506 |
atcat |
48542510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University