View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13711_high_38 (Length: 209)
Name: NF13711_high_38
Description: NF13711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13711_high_38 |
 |  |
|
| [»] scaffold0372 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0372 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: scaffold0372
Description:
Target: scaffold0372; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 2730 - 2900
Alignment:
| Q |
19 |
ttattgcggcggcgtggattttattgttggaacagattcnnnnnnnaaatgaaatattttagaatgcattctaggcgtatttactgattttcgaagcata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2730 |
ttattgcggcggcgtggattttattgttggaacagattctttttttaaatgaaatattttagaatgcattctaggcgtatttagtgattttcgaagcata |
2829 |
T |
 |
| Q |
119 |
atcggcatggatacaagttcaactgttgtcaattgaagcaatgaattttattggtaattaacttatggcat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2830 |
atcggcatggatacaagttcaactgttgtcaattgaagcaatgaattttattggtaattaacttatggcat |
2900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 19 - 189
Target Start/End: Complemental strand, 21448806 - 21448636
Alignment:
| Q |
19 |
ttattgcggcggcgtggattttattgttggaacagattcnnnnnnnaaatgaaatattttagaatgcattctaggcgtatttactgattttcgaagcata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21448806 |
ttattgcggcggcgtggattttattgttggaacagattctttttttaaatgaaatattttagaatgcattctaggcgtatttagtgattttcgaagcata |
21448707 |
T |
 |
| Q |
119 |
atcggcatggatacaagttcaactgttgtcaattgaagcaatgaattttattggtaattaacttatggcat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21448706 |
atcggcatggatacaagttcaactgttgtcaattgaagcaatgaattttattggtaattaacttatggcat |
21448636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University