View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13711_low_16 (Length: 358)

Name: NF13711_low_16
Description: NF13711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13711_low_16
NF13711_low_16
[»] chr2 (2 HSPs)
chr2 (129-337)||(21742407-21742609)
chr2 (19-48)||(21742638-21742667)


Alignment Details
Target: chr2 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 129 - 337
Target Start/End: Complemental strand, 21742609 - 21742407
Alignment:
129 tagaatatggtttaggtgcatatgcatttggtattttctacctcacttcatttcaannnnnnnaatgcaaaaataattgaagggccaaatttgactataa 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||    
21742609 tagaatatggtttaggtgcatatgcatttggtattttctacctcacttcatttcaatttttttaatgcaaaaataattgaagggccaaatttgactataa 21742510  T
229 gttagtgttacatcaaatatggtgatgaaaaggcatgaatgtagtgactgtatatgaccttgactgtacctaatcctaatctaaattattggttgtaact 328  Q
    ||||      |||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||    
21742509 gtta------catcaaatatggtgatgaaaaggcatgactgtagtgcctgtatatgaccttgactgtacctaatcctaatctaaatcattggttgtaact 21742416  T
329 tgtgagtca 337  Q
    |||||||||    
21742415 tgtgagtca 21742407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 48
Target Start/End: Complemental strand, 21742667 - 21742638
Alignment:
19 cttcagcataacattaattcagatgtacat 48  Q
    ||||||||||||||||||||||||||||||    
21742667 cttcagcataacattaattcagatgtacat 21742638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University